The pairwise alignment has been generated with the "genewise" program of the Wise2 package. The output shows the protein sequence on the first line, followed by a line indicating the similarity level of the match, followed by 4 lines representing the DNA sequence; The DNA sequence descending in triplets, each triplet being a codon. The translation of each codon is shown above it.
Between the two protein sequences a line indicating the similarity of the match is printed. "+" indicates a conservative mismatch while "- "indicates a dramatic one. Mismatches are indicated by "***" in the left column in addition to "!" at the relevant position(s).
genewise $Name: wise2-2-0 $ (unreleased release)
This program is freely distributed under a GPL. See source directory
Copyright (c) GRL limited: portions of the code are from separate copyright
Query protein: GNAI2_HUMAN
Comp Matrix: blosum62.bla
Gap open: 12
Gap extension: 2
Start/End default
Target Sequence HSGI2A1_13
Strand: forward
Start/End (protein) default
Gene Paras: human.gf
Codon Table: codon.table
Subs error: 1e-05
Indel error: 1e-05
Model splice? model
Model codon bias? flat
Model intron bias? tied
Null model syn
Algorithm 623
genewise output
Score 86.11 bits over entire alignment
Scores as bits over a synchronous coding model
Warning: The bits scores is not probablistically correct for single seqs
See WWW help for more info.
Warning: protein length=354 (x3=1062) and cDNA length=118
GNAI2_HUMAN 1 GCTVSAEDKAAAERSKMIDKNLREDGEKAAREVKLLLL
GCTVSAEDKAAAERSKMIDKNLREDGEKAAREVKLLLL
GCTVSAEDKAAAERSKMIDKNLREDGEKAAREVKLLLL
HSGI2A1_13 4 gtagagggaggggctaaagaaccggggaggcggatcct
ggctgcaaacccagcattaaatgaagaaccgatatttt
cccgccgcgggcgctggccgcgggcagggggggggggg
//
cmbi.kun.nl), 24-May-2005